Gene name |
SPCC584.08 |
Gene ID |
36/B09 |
Gene synonyms/obsolete |
cwf13; snw1;
SPCC188.11 |
Gene product |
SNW family; chromatin
binding; complexed with Cdc5p; involved in mRNA splicing;
SKIP/SNW domain; interacts with the small subunit of
U2AF |
Entry clone |
Cloned |
ORF length (unspliced) |
1765 |
ORF length (spliced) |
1674 |
Entry clone length |
1765 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
965T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC584.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCCCTTTTATCCGAAGA |
Rev primer name |
SPCC584.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGTTTTCTTTGAAGAAACA |
Amino acid length |
557 |
Molecular weight |
62.6 |
Isoelectric point (calc.) |
9.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
SPB; nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica,
DeltaVision |