Gene name |
SPAC2F3.08 |
Gene ID |
35/F11 |
Gene synonyms/obsolete |
sut1 |
Gene product |
alpha-glucoside
transporter; function overlapping with?;
glycoside-pentoside-hexuronide cation symporter family; major
facilitator superfamily; involved in maltose uptake; no
apparent Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
1728 |
ORF length (spliced) |
1662 |
Entry clone length |
1728 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
294A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC2F3.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGTAGATGAAAATCA |
Rev primer name |
SPAC2F3.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAAGTTGATGGGCAAAAGA |
Amino acid length |
553 |
Molecular weight |
61.7 |
Isoelectric point (calc.) |
6.3 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
12 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGYLLGYLPL |
Localization (YFP) |
Golgi; vacuole
membrane |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |