| Gene name |
SPAC7D4.01 |
| Gene ID |
35/F10 |
| Gene synonyms/obsolete |
itr1; SPAC4F8.15 |
| Gene product |
myo-inositol
transporter; similar to Sp itr2 (paralog); involved in
conjugation (required) and sporulation (required) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1728 |
| ORF length (spliced) |
|
| Entry clone length |
1728 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
497T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC7D4.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAATCTCTTCCAAGGA |
| Rev primer name |
SPAC7D4.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTTATTTTGCTCTTTATCT |
| Amino acid length |
575 |
| Molecular weight |
62.7 |
| Isoelectric point (calc.) |
7.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
12 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
Golgi; periphery;
vacuole membrane |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |