Gene name |
SPAC7D4.01 |
Gene ID |
35/F10 |
Gene synonyms/obsolete |
itr1; SPAC4F8.15 |
Gene product |
myo-inositol
transporter; similar to Sp itr2 (paralog); involved in
conjugation (required) and sporulation (required) |
Entry clone |
Cloned |
ORF length (unspliced) |
1728 |
ORF length (spliced) |
|
Entry clone length |
1728 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
497T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC7D4.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAATCTCTTCCAAGGA |
Rev primer name |
SPAC7D4.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTTATTTTGCTCTTTATCT |
Amino acid length |
575 |
Molecular weight |
62.7 |
Isoelectric point (calc.) |
7.6 |
Signal SEQ |
|
No. of transmembrane domain |
12 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
Golgi; periphery;
vacuole membrane |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |