| Gene name |
SPBC19F8.06c |
| Gene ID |
35/F07 |
| Gene synonyms/obsolete |
meu22 |
| Gene product |
meiotic expression
upregulated; amino acid permease family; similar to Sp
SPAP7G5.06 and SPAC869.11 and SPBC359.01 and SPBC359.01 and
SPBPB2B2.01 and isp5 |
| Entry clone |
Cloned in 2006
trial |
| ORF length (unspliced) |
1725 |
| ORF length (spliced) |
|
| Entry clone length |
1725 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC19F8.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTCTCCAAATTTTACGA |
| Rev primer name |
SPBC19F8.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAACGCATTTTTCTCTACA |
| Amino acid length |
574 |
| Molecular weight |
62.6 |
| Isoelectric point (calc.) |
8.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
12 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSFAVTVPLEL |
| Localization (YFP) |
periphery, especially
at cell tip and site of septum formation; cytoplasmic dots;
Golgi? |
| Comments for localization |
Golgi? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |