| Gene name |
SPCC126.03 |
| Gene ID |
35/E07 |
| Gene synonyms/obsolete |
lps1 |
| Gene product |
pseudouridylate
synthase; suppressor of a thermosensitive Sc los1 pus1 double
mutant; pseudouridine formation in tRNA (Trp) at position
27 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1709 |
| ORF length (spliced) |
1605 |
| Entry clone length |
1709 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC126.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGACGTGGTGGTAAACG |
| Rev primer name |
SPCC126.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGCCCTCTAAATCATCCTTG |
| Amino acid length |
534 |
| Molecular weight |
60.3 |
| Isoelectric point (calc.) |
6.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKHIEVLKL |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |