| Gene name |
SPBC215.07c |
| Gene ID |
35/E04 |
| Gene synonyms/obsolete |
|
| Gene product |
PWWP domain protein;
similar to Sp SPAC23D3.01 and SPBC29A3.13C (paralogs);
involved in cell growth |
| Entry clone |
Cloned in 2004
trial_also cloned#/ 3' FS at 1st |
| ORF length (unspliced) |
1707 |
| ORF length (spliced) |
|
| Entry clone length |
1707 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC215.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTGAAATAAAGGATTC |
| Rev primer name |
SPBC215.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTTTGACCAGTTGACAAA |
| Amino acid length |
568 |
| Molecular weight |
62.8 |
| Isoelectric point (calc.) |
4.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus |
| Comments for localization |
except nucleolus |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |