| Gene name |
SPCC1450.10c |
| Gene ID |
35/D02 |
| Gene synonyms/obsolete |
|
| Gene product |
iron only hydrogenase
large subunit; similar to human nuclear prelamin A recognition
factor |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
1695 |
| ORF length (spliced) |
1617 |
| Entry clone length |
1695 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC1450.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAAAGTTGTCTGTAAA |
| Rev primer name |
SPCC1450.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACCACTTATTGGCCAGCAAT |
| Amino acid length |
538 |
| Molecular weight |
60.4 |
| Isoelectric point (calc.) |
6.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVEMFKFLRI |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |