| Gene name |
SPBC428.19c |
| Gene ID |
35/C09 |
| Gene synonyms/obsolete |
|
| Gene product |
WD repeat protein;
ribonucleoprotein complex; processome component; involved in
rRNA processing; non-essential |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1694 |
| ORF length (spliced) |
1485 |
| Entry clone length |
1694 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
1016T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC428.19.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCGCGCCTGCTGGTAG |
| Rev primer name |
SPBC428.19.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCAGACAACATCTGAAGC |
| Amino acid length |
494 |
| Molecular weight |
54.1 |
| Isoelectric point (calc.) |
9.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
344 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLHVGGLRI |
| Localization (YFP) |
spindle microtubules;
nucleolus>>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |