| Gene name |
SPBC649.05 |
| Gene ID |
35/C05 |
| Gene synonyms/obsolete |
cut12; stf1 |
| Gene product |
links bipolar spindle
formation to mitotic control; spindle pole body protein;
essential; interacts physically with Plo1p (2-hybrid);
activator of Plo1p; no apparent orthologs |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1689 |
| ORF length (spliced) |
1647 |
| Entry clone length |
1689 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC649.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAGGTAAGGAATTCCT |
| Rev primer name |
SPBC649.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGGAATTCAACTGAAGTTCT |
| Amino acid length |
548 |
| Molecular weight |
61.9 |
| Isoelectric point (calc.) |
10 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
531/526 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
SPB; nuclear dots;
microtubules; periphery at site of septum formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |