Gene name |
SPBC649.05 |
Gene ID |
35/C05 |
Gene synonyms/obsolete |
cut12; stf1 |
Gene product |
links bipolar spindle
formation to mitotic control; spindle pole body protein;
essential; interacts physically with Plo1p (2-hybrid);
activator of Plo1p; no apparent orthologs |
Entry clone |
Cloned |
ORF length (unspliced) |
1689 |
ORF length (spliced) |
1647 |
Entry clone length |
1689 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC649.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAGGTAAGGAATTCCT |
Rev primer name |
SPBC649.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGGAATTCAACTGAAGTTCT |
Amino acid length |
548 |
Molecular weight |
61.9 |
Isoelectric point (calc.) |
10 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
531/526 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
SPB; nuclear dots;
microtubules; periphery at site of septum formation |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |