| Gene name |
SPCC1919.14c |
| Gene ID |
34/G06 |
| Gene synonyms/obsolete |
|
| Gene product |
transcription factor
TFIIIB complex; involved in transcription from Pol III
promoter; Myb family; DNA binding protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1656 |
| ORF length (spliced) |
1524 |
| Entry clone length |
1656 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
181A:G / 211T:C /
336A:G / 634A:G / 1403C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1919.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAAGGTTTGCCCCTAA |
| Rev primer name |
SPCC1919.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACCACTTGCCCGACTACC |
| Amino acid length |
507 |
| Molecular weight |
57.6 |
| Isoelectric point (calc.) |
5.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |