| Gene name |
SPBP4H10.06c |
| Gene ID |
34/A08 |
| Gene synonyms/obsolete |
cut14 |
| Gene product |
condensin subunit;
SMC2 subunit; essential; involved in chromosome condensation
(mitosis) (required); involved in chromosome segregation
(mitosis) (required) |
| Entry clone |
Cloned in 2006
trial |
| ORF length (unspliced) |
3519 |
| ORF length (spliced) |
|
| Entry clone length |
3519 |
| No. of intron |
0 |
| Sequence status |
Partially
sequenced |
| Sequence results |
100% match in both
ends |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBP4H10.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAATAGAGGAACTCAT |
| Rev primer name |
SPBP4H10.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGCGAGCTTGTACCACAGAT |
| Amino acid length |
1172 |
| Molecular weight |
134.1 |
| Isoelectric point (calc.) |
8.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDAICFVLGI/LPELDRLIL/LDEIDAALDL |
| Localization (YFP) |
no expression clone
|
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|