Gene name |
SPAC25G10.04c |
Gene ID |
33/G11 |
Gene synonyms/obsolete |
rec10 |
Gene product |
involved in meiotic
recombination (required); involved in sister chromatid
cohesion; no apparent orthologs |
Entry clone |
Cloned |
ORF length (unspliced) |
2376 |
ORF length (spliced) |
|
Entry clone length |
2376 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
909T:C / 1651G:A /
2051C:T |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC25G10.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACATATTTTCTGAGTT |
Rev primer name |
SPAC25G10.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTTAAACATCAAACTGTCA |
Amino acid length |
791 |
Molecular weight |
89.8 |
Isoelectric point (calc.) |
6.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
485 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIESFTSLEI |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |