| Gene name |
SPBC1539.09c |
| Gene ID |
33/G02 |
| Gene synonyms/obsolete |
trp1 |
| Gene product |
anthranilate synthase
component II; includes, glutamineamidotransferase,
indole-3-glycerol phophate synthase, N-(5'-phosphoribosyl)
anthranilate isomerase |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2280 |
| ORF length (spliced) |
|
| Entry clone length |
2280 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
538G:A / 1213A:G /
2045T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1539.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGAAAAAGTTGACGT |
| Rev primer name |
SPBC1539.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGTTCTTTTACGGCGTTT |
| Amino acid length |
759 |
| Molecular weight |
83 |
| Isoelectric point (calc.) |
6.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEKLNPLKL |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |