| Gene name |
SPAC27D7.03c |
| Gene ID |
33/G01 |
| Gene synonyms/obsolete |
mei2 |
| Gene product |
meiotic regulator;
function facilitated by Mip1p; undergoes nucleocytoplasmic
shuttling; required for commitment to meiosis; sufficient for
commitment to meiosis (unphosphorylated form); rrm RNA
recognition motif (3); putative splicing regulator;
phosphorylated by Pat1p; phosphorylation inhibits sexual
differentiation via ubiquitin proteolysis and 14-3-3 protein;
no apparent Sc ortholog; RNA-binding protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2253 |
| ORF length (spliced) |
|
| Entry clone length |
2253 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1479T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC27D7.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATTATGGAAACCGAATC |
| Rev primer name |
SPAC27D7.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACATTTGCTTGCAGTTGGA |
| Amino acid length |
750 |
| Molecular weight |
82.6 |
| Isoelectric point (calc.) |
7.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQTFGPLLI |
| Localization (YFP) |
cytosol; cytoplasmic
dots by over expression |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
cytosol=nucleus, partially |
| Microscope used for
observation |
DeltaVision |