| Gene name |
SPAC17C9.01c |
| Gene ID |
33/F10 |
| Gene synonyms/obsolete |
nuc2;
SPAC1851.01c |
| Gene product |
anaphase-promoting
complex (APC); involved in G1 arrest after nitrogen starvation
(required); involved in cyclin degradation; involved in
metaphase-anaphase transition; involved in cytokinesis
(regulation); involved in septation (regulation)
(negative) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2149 |
| ORF length (spliced) |
1998 |
| Entry clone length |
2149 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC17C9.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACAGATCGATTGAAATG |
| Rev primer name |
SPAC17C9.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGTTTCCAGATTCCTATAA |
| Amino acid length |
665 |
| Molecular weight |
76.1 |
| Isoelectric point (calc.) |
7.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNCFQSLPI |
| Localization (YFP) |
periphery at site of
septum formation; nucleus>cytosol |
| Comments for localization |
cytoplasmic dots and
aggregates by over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |