| Gene name |
SPAC22E12.09c |
| Gene ID |
33/F09 |
| Gene synonyms/obsolete |
krp1; krp |
| Gene product |
kexin; peptidase
activity; serine protease; serine-type endopeptidase activity;
peptidase family S8; specificity dibasic amino acids; calcium
dependent; peptide pheromone maturation; mutant rescued by the
overexpression of yps1; mutant rescued by the overexpression
of pgp1 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2130 |
| ORF length (spliced) |
|
| Entry clone length |
2130 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
658A:G / 737A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC22E12.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCATCCTGCTTTGCTATG |
| Rev primer name |
SPAC22E12.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCAATTTCTTGCTGAGAC |
| Amino acid length |
709 |
| Molecular weight |
78.1 |
| Isoelectric point (calc.) |
4.9 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LASAVYALAL |
| Localization (YFP) |
Golgi |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |