Gene name |
SPBC3E7.03c |
Gene ID |
33/F02 |
Gene synonyms/obsolete |
ste2 |
Gene product |
pseudogene; pseudo;
gag acceptor; frameshifted |
Entry clone |
Cloned |
ORF length (unspliced) |
2005 |
ORF length (spliced) |
1440 |
Entry clone length |
2005 |
No. of intron |
5 |
Sequence status |
Finished |
Sequence results |
1019A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC3E7.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTGCTTAAAAGGAATGGA |
Rev primer name |
SPBC3E7.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCAGAATCATTATCATCC |
Amino acid length |
479 |
Molecular weight |
54.7 |
Isoelectric point (calc.) |
5.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>>cytosol |
Comments for localization |
nuclear dots and
cytoplasmic dots by over expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |