| Gene name |
SPBC3E7.03c |
| Gene ID |
33/F02 |
| Gene synonyms/obsolete |
ste2 |
| Gene product |
pseudogene; pseudo;
gag acceptor; frameshifted |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2005 |
| ORF length (spliced) |
1440 |
| Entry clone length |
2005 |
| No. of intron |
5 |
| Sequence status |
Finished |
| Sequence results |
1019A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC3E7.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTGCTTAAAAGGAATGGA |
| Rev primer name |
SPBC3E7.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCAGAATCATTATCATCC |
| Amino acid length |
479 |
| Molecular weight |
54.7 |
| Isoelectric point (calc.) |
5.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>>cytosol |
| Comments for localization |
nuclear dots and
cytoplasmic dots by over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |