| Gene name |
SPAC3A11.05c |
| Gene ID |
33/F01 |
| Gene synonyms/obsolete |
kms1 |
| Gene product |
meiosis specific
protein; required for the formation of meiotic prophase
specific nuclear architecture; involved in telomere clustering
during meiotic prophase; mutant displays decreased meiotic
recombination; predicted coiled-coil region; 2 predicted
transmembrane helices; no apparent orthologs |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2001 |
| ORF length (spliced) |
1824 |
| Entry clone length |
2001 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
1847T:C /
1967T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC3A11.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTAAATGAACGCGATTT |
| Rev primer name |
SPAC3A11.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGAAGGCTGTACCAGTTCA |
| Amino acid length |
607 |
| Molecular weight |
69.2 |
| Isoelectric point (calc.) |
6.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
2 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPIINDLQL/LRLFYVLFL |
| Localization (YFP) |
SPB; ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |