| Gene name |
SPBC25H2.12c |
| Gene ID |
33/E10 |
| Gene synonyms/obsolete |
cct7 |
| Gene product |
chaperonin-containing
T-complex; T-complex protein 1 (eta subunit); involved in
protein folding; involved in actin folding; involved in
tubulin folding |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1886 |
| ORF length (spliced) |
1677 |
| Entry clone length |
1886 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
62T:C / 152A:G /
712A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC25H2.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGCTTGGAGGTCCTCA |
| Rev primer name |
SPBC25H2.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGCGGGGCATTCCTCGACCT |
| Amino acid length |
558 |
| Molecular weight |
60.6 |
| Isoelectric point (calc.) |
5.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |