Gene name |
SPBC21H7.05 |
Gene ID |
33/E09 |
Gene synonyms/obsolete |
sfc6 |
Gene product |
RNA polymerase III
transcription factor (TFIIIC subunit) (putative); WD repeat
protein; AT hook (inferred) |
Entry clone |
Cloned |
ORF length (unspliced) |
1881 |
ORF length (spliced) |
1749 |
Entry clone length |
1881 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
1315C:T |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC21H7.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGCCCTAAATCTAAGGA |
Rev primer name |
SPBC21H7.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATCTTCTTTCAACGGCTGAG |
Amino acid length |
582 |
Molecular weight |
66.2 |
Isoelectric point (calc.) |
6.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFEVKNLSI/LDDFPWLFL |
Localization (YFP) |
nucleus>>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |