Gene name |
SPBC16A3.05c |
Gene ID |
33/B04 |
Gene synonyms/obsolete |
rae1 |
Gene product |
WD repeat protein;
poly(A)+ RNA export protein; nuclear pore complex; involved in
nuclear import; involved in nuclear export; involved in
nuclear export of the small ribosomal subunit; interacts
physically with Mex67p (in RNA export); involved in mitotic
progression (required) |
Entry clone |
Cloned |
ORF length (unspliced) |
1528 |
ORF length (spliced) |
1059 |
Entry clone length |
1528 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
39T:C / 176A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC16A3.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCACTTTTTGGACAGGC |
Rev primer name |
SPBC16A3.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACCTTCCTTTCTTAGGTCGA |
Amino acid length |
352 |
Molecular weight |
38.6 |
Isoelectric point (calc.) |
8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nuclear envelope
|
Comments for localization |
SPB? |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |