Gene name |
SPBC543.07 |
Gene ID |
32/E04 |
Gene synonyms/obsolete |
skh1; pek1; mkk1 |
Gene product |
serine/threonine
protein kinase; MAP kinase kinase (MAPKK); acts as a
phosphorylation-dependent molecular switch; mkh1 signaling
pathway component |
Entry clone |
Cloned |
ORF length (unspliced) |
1092 |
ORF length (spliced) |
|
Entry clone length |
1092 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC543.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCAAAAAACCTGTCTT |
Rev primer name |
SPBC543.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCAGACCAGACTTGACGA |
Amino acid length |
363 |
Molecular weight |
40.7 |
Isoelectric point (calc.) |
8.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LQKQLLRELKI |
Localization (YFP) |
nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |