| Gene name |
SPBC32F12.02 |
| Gene ID |
32/B07 |
| Gene synonyms/obsolete |
rec14 |
| Gene product |
WD repeat protein;
involved in meiotic recombination |
| Entry clone |
Cloned#/Sequence
mismatch |
| ORF length (unspliced) |
962 |
| ORF length (spliced) |
909 |
| Entry clone length |
962 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
9A:deletion |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC32F12.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGGAAAGAGTATCTCGT |
| Rev primer name |
SPBC32F12.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCTGTAGCAGCAGCTCTA |
| Amino acid length |
302 |
| Molecular weight |
32.9 |
| Isoelectric point (calc.) |
4.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus? |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |