Gene name |
SPBP16F5.04 |
Gene ID |
32/B06 |
Gene synonyms/obsolete |
ubc3; ubcp3 |
Gene product |
ubiquitin conjugating
enzyme; involved in transcriptional silencing of the
mating-type region; overexpression derepressed transcriptional
silencing of the mating-type region |
Entry clone |
Cloned# |
ORF length (unspliced) |
946 |
ORF length (spliced) |
501 |
Entry clone length |
946 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBP16F5.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTAAAGCTATGGCGTT |
Rev primer name |
SPBP16F5.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATAATCCCAAGGTTTTACGA |
Amino acid length |
166 |
Molecular weight |
18.7 |
Isoelectric point (calc.) |
4.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |