Gene name |
SPBC1709.18 |
Gene ID |
32/A06 |
Gene synonyms/obsolete |
tif452;
SPBC409.01 |
Gene product |
translation initiation
factor (eIF4E subunit); eIF4G-binding |
Entry clone |
Cloned |
ORF length (unspliced) |
879 |
ORF length (spliced) |
732 |
Entry clone length |
879 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
206A:G / 463T:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC1709.18.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAGATGCAGAAGACTC |
Rev primer name |
SPBC1709.18.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAGACTCATACGGGTTTTT |
Amino acid length |
243 |
Molecular weight |
27.6 |
Isoelectric point (calc.) |
7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
nucleus>cytosol |
Microscope used for
observation |
Leica |