| Gene name |
SPAC30.04c |
| Gene ID |
30/H01 |
| Gene synonyms/obsolete |
|
| Gene product |
ABC transporter
family; similar to Sp SPAC9E9.12C |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4410 |
| ORF length (spliced) |
|
| Entry clone length |
4410 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
2337T:C /
2393A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC30.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAAACTTTCACCATCG |
| Rev primer name |
SPAC30.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGCTGATTTCGAACCTCGA |
| Amino acid length |
1469 |
| Molecular weight |
164.7 |
| Isoelectric point (calc.) |
8.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
15 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKVTLETCLIL/LTCLFDYLFL/LNIIQGYLDL/LQNCVGYLTL |
| Localization (YFP) |
ambiguous
structure |
| Comments for localization |
near nucleus |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |