Gene name |
SPAC17A5.14 |
Gene ID |
30/F03 |
Gene synonyms/obsolete |
exo2 |
Gene product |
exonuclease II;
zf-C2H2 type; mutants are caffeine sensitive |
Entry clone |
Cloned |
ORF length (unspliced) |
4075 |
ORF length (spliced) |
3987 |
Entry clone length |
4075 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC17A5.14.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGAATTCCAAAGGTTGT |
Rev primer name |
SPAC17A5.14.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTTAATCTGAAGTTTGCCC |
Amino acid length |
1328 |
Molecular weight |
152.5 |
Isoelectric point (calc.) |
7.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDADLIMLGL/LPHLPGLHI/LRRLCNDLHL/LLNIHPLLL |
Localization (YFP) |
cytosol; cytoplasmic
dots |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus>>cytosol) |
Microscope used for
observation |
Leica |