| Gene name |
SPCC4B3.04c |
| Gene ID |
30/F02 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical protein;
cyclic nucleic acid binding family protein; patatin-like
phospholipase |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4057 |
| ORF length (spliced) |
3951 |
| Entry clone length |
4057 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
267T:C / 654A:G /
1333A:G / 1460T:A / 1999A:G / 2726A:G / 3970A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC4B3.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACATCACAGATCGTAT |
| Rev primer name |
SPCC4B3.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACAAAGAATTACGTCTTGAA |
| Amino acid length |
1316 |
| Molecular weight |
147.8 |
| Isoelectric point (calc.) |
8 |
| Signal SEQ |
|
| No. of transmembrane domain |
2 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSSFFTVLEL/LISLVPSLLL |
| Localization (YFP) |
cytoplasmic dots |
| Comments for localization |
aggregates by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |