| Gene name |
SPAC1F5.12 |
| Gene ID |
30/D11 |
| Gene synonyms/obsolete |
trk2;
SPAC1639.02c |
| Gene product |
similar to Sp trk1;
TrkH domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3377 |
| ORF length (spliced) |
2643 |
| Entry clone length |
3377 |
| No. of intron |
11 |
| Sequence status |
Finished |
| Sequence results |
1541G:C /
2807A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1F5.12.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAGTTATCGGGTTTTTC |
| Rev primer name |
SPAC1F5.12.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGAACTGGGTACCGGGTCT |
| Amino acid length |
880 |
| Molecular weight |
99.8 |
| Isoelectric point (calc.) |
9.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
8 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRYIDALLL/LSTPITVNLGL/LSHDLWYLFL |
| Localization (YFP) |
no apparent signal
|
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |