Gene name |
SPAC26H5.12 |
Gene ID |
30/D10 |
Gene synonyms/obsolete |
|
Gene product |
DNA-directed RNA
polymerase |
Entry clone |
Cloned |
ORF length (unspliced) |
3363 |
ORF length (spliced) |
|
Entry clone length |
3363 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
625A:G / 2046C:T |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC26H5.12.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCCATTGAAGCGTACGA |
Rev primer name |
SPAC26H5.12.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGAGAAAAAATACTTACTC |
Amino acid length |
1120 |
Molecular weight |
127.2 |
Isoelectric point (calc.) |
8.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLPMINLYI |
Localization (YFP) |
cytosol; cytoplasmic
dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |