| Gene name |
SPBC800.10c |
| Gene ID |
30/D08 |
| Gene synonyms/obsolete |
|
| Gene product |
actin cortical patch
component; involved in endocytosis; predicted coiled-coil
region; EF hand motifs; similar to Sp SPBC83.01 and
SPAC25G10.09C |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3351 |
| ORF length (spliced) |
|
| Entry clone length |
3351 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC800.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTTGAATTTGTCTGC |
| Rev primer name |
SPBC800.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATGATGCCCAGCATGTTCT |
| Amino acid length |
1116 |
| Molecular weight |
120.5 |
| Isoelectric point (calc.) |
4.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
925 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytoplasmic dots at
periphery |
| Comments for localization |
large aggregates by
over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |