Gene name |
SPAC1F3.02c |
Gene ID |
30/D07 |
Gene synonyms/obsolete |
mkh1; pmk1 |
Gene product |
serine/threonine
protein kinase; involved in cell wall organization and
biogenesis, osmotic stress response, heat shock respone,
chloride homeostasis; sterile alpha motif (SAM) |
Entry clone |
Cloned |
ORF length (unspliced) |
3351 |
ORF length (spliced) |
|
Entry clone length |
3351 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
788A:G / 1955A:T |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC1F3.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTGCCGATATCGGATC |
Rev primer name |
SPAC1F3.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGCTCTTTCTTTTACAAAGC |
Amino acid length |
1116 |
Molecular weight |
125.1 |
Isoelectric point (calc.) |
8.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEERFEQSLHL/LNSVLQFLKL |
Localization (YFP) |
periphery at cell tip
and site of septum formation; cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |