Gene name |
SPCC1739.11c |
Gene ID |
30/B01 |
Gene synonyms/obsolete |
cdc11 |
Gene product |
involved in septation;
SIN component; leucine-rich repeat protein; localizes
components of the SIN to the SPB; phosphoprotein;
essential |
Entry clone |
Cloned; Mixture |
ORF length (unspliced) |
3138 |
ORF length (spliced) |
|
Entry clone length |
3138 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC1739.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAACAGTTATGGCTTGA |
Rev primer name |
SPCC1739.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTTGGATGATTTGGTGAAT |
Amino acid length |
1045 |
Molecular weight |
118.6 |
Isoelectric point (calc.) |
6.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSSFHDLSL/LCPSIEELTL/LTSFSNLLNL/LHRLEELLL/LQNLMVLQL/LQMIHRLYL/LKQLNVLDL |
Localization (YFP) |
SPB; nuclear dots;
periphery at site of septum formation; cytoplasmic dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica,
DeltaVision |