Gene name |
SPBP8B7.19 |
Gene ID |
29/H10 |
Gene synonyms/obsolete |
|
Gene product |
FACT complex
component; chromatin binding activity; involved in chromatin
mediated transcriptional regulation; involved in DNA
replication; involved in chromatin remodeling; chromatin
assembly/disassembly; alpha DNA polymerase primase complex;
involved in RNA elongation from Pol II promoter; transcription
elongation factor complex |
Entry clone |
Cloned |
ORF length (unspliced) |
3060 |
ORF length (spliced) |
|
Entry clone length |
3060 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1443T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBP8B7.19.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTGAATATGAAATAGA |
Rev primer name |
SPBP8B7.19.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACCGGTGTCTCTTTTTAGAT |
Amino acid length |
1019 |
Molecular weight |
116.4 |
Isoelectric point (calc.) |
4.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
758 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGYEFPSTLIL/LQAGMTLNLSI/LPQAIGELRI |
Localization (YFP) |
SPB?; nucleus; nuclear
dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |