Gene name |
SPAC13G6.06c |
Gene ID |
29/H09 |
Gene synonyms/obsolete |
|
Gene product |
glycine dehydrogenase
(decarboxylating); involved in glycine metabolism; glycine
dehydrogenase (decarboxylating) activity |
Entry clone |
Cloned; Mixture |
ORF length (unspliced) |
3054 |
ORF length (spliced) |
|
Entry clone length |
3054 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1215T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC13G6.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTCGTGCTTGCTCGAA |
Rev primer name |
SPAC13G6.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAACAACTGGGGAACAAGTA |
Amino acid length |
1017 |
Molecular weight |
112.5 |
Isoelectric point (calc.) |
7.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSWPIANTLMI |
Localization (YFP) |
mitochondrion |
Comments for localization |
aggregates |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal
|