Gene name |
SPCC10H11.01 |
Gene ID |
29/H07 |
Gene synonyms/obsolete |
prp11 |
Gene product |
DEAD/DEAH box
helicase; RNA helicase; involved in mRNA splicing (IGI) |
Entry clone |
Cloned |
ORF length (unspliced) |
3045 |
ORF length (spliced) |
|
Entry clone length |
3045 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC10H11.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTAGAAGAACACGATC |
Rev primer name |
SPCC10H11.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGACAACTGTGTATCGTCCA |
Amino acid length |
1014 |
Molecular weight |
114.2 |
Isoelectric point (calc.) |
8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
SPB?;
nucleus>=cytosol |
Comments for localization |
bright nuclear dots by
over expression |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |