| Gene name |
SPCC962.02c |
| Gene ID |
29/H06 |
| Gene synonyms/obsolete |
cut17; pbh1; bir1;
SPCP31B10.10c |
| Gene product |
survivin; inhibitor of
apoptosis domain; involved in chromosome segregation
(required); involved in chromosome condensation (required);
involved in spindle elongation (required) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3041 |
| ORF length (spliced) |
2994 |
| Entry clone length |
3041 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
329C:T / 2942T:C /
2990A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC962.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAACCGATAACGTCTTC |
| Rev primer name |
SPCC962.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAAGTTTTGTATGTATTCT |
| Amino acid length |
997 |
| Molecular weight |
112.5 |
| Isoelectric point (calc.) |
4.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIDLIPLLAI |
| Localization (YFP) |
nucleus; a few nuclear
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |