| Gene name |
SPCC16A11.04 |
| Gene ID |
29/H04 |
| Gene synonyms/obsolete |
|
| Gene product |
sorting nexin; PX
domain; phosphoinositide binding; involved in intracellular
protein transport; RGS domain, regulator of G-protein
signaling; similar domain arrangement to human SNX13 |
| Entry clone |
Cloned in 2006
trial |
| ORF length (unspliced) |
3033 |
| ORF length (spliced) |
|
| Entry clone length |
3033 |
| No. of intron |
0 |
| Sequence status |
Partially
sequenced |
| Sequence results |
100% match in both
ends |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC16A11.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTACCAGCAGCATATCTT |
| Rev primer name |
SPCC16A11.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGTTGCCTTATTAGTTGAT |
| Amino acid length |
1010 |
| Molecular weight |
116.9 |
| Isoelectric point (calc.) |
9.3 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
275 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPLITKHLRL/LFEQVQSLLQI |
| Localization (YFP) |
no expression clone
|
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|