| Gene name |
SPCC1020.01c |
| Gene ID |
29/H03 |
| Gene synonyms/obsolete |
pma2;
SPCC1393.01 |
| Gene product |
P-type proton ATPase;
P3 type |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3033 |
| ORF length (spliced) |
|
| Entry clone length |
3033 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
2877A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1020.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAACGAAATAACGGCGA |
| Rev primer name |
SPCC1020.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACTAGTGACTTTACCTTCG |
| Amino acid length |
1010 |
| Molecular weight |
110.1 |
| Isoelectric point (calc.) |
5.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
9 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
499 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLVLVILTL/LAALLEYTLAI |
| Localization (YFP) |
periphery at cell tip
and site of septum formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal
|