| Gene name |
SPAC26F1.01 |
| Gene ID |
29/D09 |
| Gene synonyms/obsolete |
sec74;
SPAPJ691.01c |
| Gene product |
Sec7 domain;
pleckstrin homology domain; domain combination also occurs in
human and C. elegans cytohesins; homologs appear to be guanine
nucleotide exchange factor for ADP-ribosylation factors; binds
phosphoinositides and/or involved in vesicular transport |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2787 |
| ORF length (spliced) |
|
| Entry clone length |
2787 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC26F1.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGACGAATCTTCTCGTAT |
| Rev primer name |
SPAC26F1.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTCACGCAAAAAATCATCG |
| Amino acid length |
928 |
| Molecular weight |
103.6 |
| Isoelectric point (calc.) |
8.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
periphery at cell tip
and site of septum formation; cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |