| Gene name |
SPAC664.10 |
| Gene ID |
29/A08 |
| Gene synonyms/obsolete |
|
| Gene product |
kinesin-like
protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2499 |
| ORF length (spliced) |
2454 |
| Entry clone length |
2499 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
18T:A / 752A:G /
969A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC664.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAGAAGAAGGACATAA |
| Rev primer name |
SPAC664.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTTGTGACTTTGCGTGCT |
| Amino acid length |
817 |
| Molecular weight |
91 |
| Isoelectric point (calc.) |
7.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
microtubules |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
intranuclear microtubule bundle (nucleus) |
| Microscope used for
observation |
Confocal |