Gene name |
SPAC23A1.04c |
Gene ID |
28/F12 |
Gene synonyms/obsolete |
|
Gene product |
glycosyl hydrolase
family 47 |
Entry clone |
Cloned |
ORF length (unspliced) |
2421 |
ORF length (spliced) |
2364 |
Entry clone length |
2421 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
7A:T / 325A:G /
1096A:G / 2055A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC23A1.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGTAGCTTGCACTCGAT |
Rev primer name |
SPAC23A1.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGCTGTTTATGCATTTCAGA |
Amino acid length |
787 |
Molecular weight |
89.3 |
Isoelectric point (calc.) |
5.1 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LHSIFCVCLIL/LSAYFPGLLVL/LSETLKYLFL |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |