| Gene name |
SPAC23A1.04c |
| Gene ID |
28/F12 |
| Gene synonyms/obsolete |
|
| Gene product |
glycosyl hydrolase
family 47 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2421 |
| ORF length (spliced) |
2364 |
| Entry clone length |
2421 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
7A:T / 325A:G /
1096A:G / 2055A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC23A1.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGTAGCTTGCACTCGAT |
| Rev primer name |
SPAC23A1.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGCTGTTTATGCATTTCAGA |
| Amino acid length |
787 |
| Molecular weight |
89.3 |
| Isoelectric point (calc.) |
5.1 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LHSIFCVCLIL/LSAYFPGLLVL/LSETLKYLFL |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |