| Gene name |
SPBP4H10.02c |
| Gene ID |
28/F11 |
| Gene synonyms/obsolete |
SPBC1346.03;
SPBP19A11.07c |
| Gene product |
hypothetical protein;
no apparent Sc ortholog; similar to Sp SPAP27G11.12
(paralog) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2419 |
| ORF length (spliced) |
2031 |
| Entry clone length |
2419 |
| No. of intron |
8 |
| Sequence status |
Finished |
| Sequence results |
92A:G / 96T:C / 817T:C
/ 927A:G / 1118T:C / 1419A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBP4H10.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGATCCGCGGAATCCAA |
| Rev primer name |
SPBP4H10.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACGAAAAAAGTCTACCTTGG |
| Amino acid length |
676 |
| Molecular weight |
78.2 |
| Isoelectric point (calc.) |
6.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLQVCVLNI/LKPLLSELGL/LINNFNDNLHI |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |