| Gene name |
SPAC14C4.11 |
| Gene ID |
28/F08 |
| Gene synonyms/obsolete |
|
| Gene product |
polyphosphate
synthetase; similar to Sp SPCC1322.14C (paralog) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2412 |
| ORF length (spliced) |
2205 |
| Entry clone length |
2412 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
638A:T / 2342T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC14C4.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGTTTCAGTGACAGTAT |
| Rev primer name |
SPAC14C4.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGTAAACAATTTAACAAGC |
| Amino acid length |
734 |
| Molecular weight |
85.4 |
| Isoelectric point (calc.) |
7.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
3 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDPISTCLYL |
| Localization (YFP) |
ambiguous
structure |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |