Gene name |
SPAC20G8.01 |
Gene ID |
28/F07 |
Gene synonyms/obsolete |
cdc17;
SPAC57A10.13c |
Gene product |
DNA ligase;
ATP-dependent; involved in DNA replication; functionally
complemented by Sc CDC9; does not functionally complement Sc
CDC9; induced by UV-irradiation; involved in telomere
maintenance |
Entry clone |
Cloned |
ORF length (unspliced) |
2409 |
ORF length (spliced) |
2307 |
Entry clone length |
2409 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
110A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC20G8.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGAACAGTATTTTCGCA |
Rev primer name |
SPAC20G8.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATAATCTTCGGCAGCTGGG |
Amino acid length |
768 |
Molecular weight |
86.5 |
Isoelectric point (calc.) |
7.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIRALEGKLRL |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |