| Gene name |
SPAC20G8.01 |
| Gene ID |
28/F07 |
| Gene synonyms/obsolete |
cdc17;
SPAC57A10.13c |
| Gene product |
DNA ligase;
ATP-dependent; involved in DNA replication; functionally
complemented by Sc CDC9; does not functionally complement Sc
CDC9; induced by UV-irradiation; involved in telomere
maintenance |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2409 |
| ORF length (spliced) |
2307 |
| Entry clone length |
2409 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
110A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC20G8.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGAACAGTATTTTCGCA |
| Rev primer name |
SPAC20G8.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATAATCTTCGGCAGCTGGG |
| Amino acid length |
768 |
| Molecular weight |
86.5 |
| Isoelectric point (calc.) |
7.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIRALEGKLRL |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |