Gene name |
SPBC887.04c |
Gene ID |
28/B06 |
Gene synonyms/obsolete |
|
Gene product |
WD repeat protein;
PLAP family; involved in ubiquitin-dependent proteolysis;
interacts physically with SPAC1565.08; involved in DNA repair;
RAD6 epistasis group; similar to mammalian phospholipase
a-2-activating protein |
Entry clone |
Cloned |
ORF length (unspliced) |
2268 |
ORF length (spliced) |
2142 |
Entry clone length |
2268 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
2069T:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC887.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACCTCTTATGAACTTTC |
Rev primer name |
SPBC887.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAAGAGTGAAAGGATTTGC |
Amino acid length |
713 |
Molecular weight |
78.6 |
Isoelectric point (calc.) |
4.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDALRLLAI/LAMNLSILLI |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Leica |