| Gene name |
SPAC767.01c |
| Gene ID |
27/G07 |
| Gene synonyms/obsolete |
vps1;
SPAC9G1.14c |
| Gene product |
dynamin family;
GTPase; involved in intracellular protein transport |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2088 |
| ORF length (spliced) |
2037 |
| Entry clone length |
2088 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
151C:G / 654A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC767.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATCCCTCATTGATTAA |
| Rev primer name |
SPAC767.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACGTTAGACACAATCTCA |
| Amino acid length |
678 |
| Molecular weight |
75.7 |
| Isoelectric point (calc.) |
7.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAGRVIPLRL |
| Localization (YFP) |
Golgi; cytoplasmic
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal,
DeltaVision |