Gene name |
SPCC74.03c |
Gene ID |
27/F02 |
Gene synonyms/obsolete |
|
Gene product |
serine/threonine
protein kinase; involved in the regulation of carbohydrate
metabolism; similar to Sp SPAC23H4.02 |
Entry clone |
Cloned |
ORF length (unspliced) |
2041 |
ORF length (spliced) |
1731 |
Entry clone length |
2041 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
1426A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC74.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAACCGCAGGAGGTTGA |
Rev primer name |
SPCC74.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGCAGAAAATAACTTGCAC |
Amino acid length |
576 |
Molecular weight |
65.9 |
Isoelectric point (calc.) |
8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKSSFPFLDL |
Localization (YFP) |
SPB?; cytosol=nucleus;
cytoplasmic dots |
Comments for localization |
SPB on abnormal
spindle? |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |