| Gene name |
SPBC1778.10c |
| Gene ID |
26/G10 |
| Gene synonyms/obsolete |
SPBC4C3.11 |
| Gene product |
phosphoinositide-dependent protein kinase 1;
serine/threonine protein kinase; PKC subfamily; similar to Sp
ksg1 (paralog) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1923 |
| ORF length (spliced) |
1653 |
| Entry clone length |
1923 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
610T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC1778.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATCTGGAGCATAAACG |
| Rev primer name |
SPBC1778.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTCTTCCTCGTTCTCTTCT |
| Amino acid length |
550 |
| Molecular weight |
62.5 |
| Isoelectric point (calc.) |
8.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFHTFQDDLKL |
| Localization (YFP) |
SPB; nuclear dots;
periphery at site of septum formation and cell tip;
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |