Gene name |
SPAC23A1.06c |
Gene ID |
26/G08 |
Gene synonyms/obsolete |
cmk2 |
Gene product |
MAPK-activated protein
kinase; serine/threonine protein kinase; calmodulin dependent;
involved in oxidative stress response (required);
overexpression suppresses DNA replication checkpoint defects;
involved in G2/M phase progression; non-essential; similar to
Sp SPCC1322.08 (paralog); interacts physically with Sty1p;
phosphorylated by Sty1p; overexpression blocks the cell cycle
at G2 phase |
Entry clone |
Cloned |
ORF length (unspliced) |
1922 |
ORF length (spliced) |
1515 |
Entry clone length |
1922 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
1394C:T /
1413C:T |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC23A1.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGATACTAGCGGTACG |
Rev primer name |
SPAC23A1.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATTAACACGTTTAGCAGAT |
Amino acid length |
504 |
Molecular weight |
56.6 |
Isoelectric point (calc.) |
6.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
periphery |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |